레딧을 돌아다니다가 본 글인데 공감이 되어 퍼왔다 # 컴퓨터 전공자가 생물정보학을 전공하는 것은 쉬울까? From the bioinformatics community on Reddit Explore this post and more from the bioinformatics community www.reddit.com You can apply software engineering to binf, as there's a lot of engineering roles within large hospitals and labs for developing bioinformatics tools (including web apps) and doing data engineering type work, ETL pipeli..
분류 전체보기

K-Fold Cross Validation 이란? overfitting을 막기 위해서 데이터를 쪼갠 다름에 k개로 나누어 train데이터 안에서도 일부는 훈련, 일부는 테스트 데이터 셋으로 나뉜다. repeated k-fold는 이러한 과정을 N번 반복하며, 과정마다 각기 다른 데이터 셋이 훈련 및 테스트된다. macro average ROC curve란? 세 그룹 이상 범주형 데이터를 분류할때, ROC curve를 나타내는 방법을 말한다. 만약 A, B, C그룹이 있다면, A vs B + C로 분류의 정확도를 비교하여 평균 내는 방법이다. Multiclass Receiver Operating Characteristic (ROC) Multiclass Receiver Operating Characteris..
# 데이터 처리 X = x.value y feature_names = list(x.column) # 모델 model = xgb.XGBClassifier() model.fit(X, y) # 이름 붙이기 # https://stackoverflow.com/questions/46943314/xgboost-plot-importance-doesnt-show-feature-names model.get_booster().feature_names = feature_names xgb.plot_importance(model.get_booster()) # importance importance = model.feature_importances_ # 저장 importance_df = pd.DataFrame({'Feature':..

최근 엑스(구 트위터)를 설치했다. 설치한 이유는 해외 생물정보학, 마이크로바이옴 연구자들과 교수님들이 트위터로 의견을 교환하는 장면을 보고 나서였다. 한국에 거주하는 나로서는 해외에서 어떤 연구가 핫한지 실시간으로 알 수 있는 방법이 없었는데, 엑스를 통해 가능하게 되었다. 최근 엑스에서 핫한 주제라면 바로 아래에 있는 그림이다. 이는 16S에서 Species추정이 얼마나 불확실한지 알려주는 그림이다. Terrifying plot for microbiome profiling - 16S연구의 한계를 명확히 보여주는 그림이다. - 분석 도구(DADA2, QIIME 2, Mothur, PathoScope, and Kraken 2)와 DB(SILVA, Greengene, Kraken Std, RefSeq)을 ..

수정: 2025/02/06 Maaslin2(Microbiome Multivariable Associations with Linear Models)이란?- 홈페이지 : https://huttenhower.sph.harvard.edu/maaslin/- Lefse를 개발한 하버드 연구소에서 만든 Differential abundance analysis 도구이다. R package로 제공되며 유전자 표현형, 환경, 미생물 분석에 사용할 수 있다. MaAsLin2은 일반적인 선형모델을 가정하며, 대부분의 역학적 연구 디자인이나, cross-sectional, longitudinal에서 사용할 수 있다. Maaslin2에서 3 그룹에서 분석하기 1. 설치 if(!requireNamespace("BiocMana..
Problem Given: fasta 형식으로 이루어진 대략 1000 길이의 DNA 서열과, 서열의 intron 서열 Return: S의 exon부분이 전사 된 단백질 서열 Sample Dataset >Rosalind_10 ATGGTCTACATAGCTGACAAACAGCACGTAGCAATCGGTCGAATCTCGAGAGGCATATGGTCACATGATCGGTCGAGCGTGTTTCAAAGTTTGCGCCTAG >Rosalind_12 ATCGGTCGAA >Rosalind_15 ATCGGTCGAGCGTGT Sample Output MVYIADKQHVASREAYGHMFKVCA 예제 데이터 풀이 1. RNA서열에서 Intron 서열을 제외한다. 2. 남은 Exon서열을 protein으로 번역한다. 풀이 ## 1. 파일 ..

작성 2023.09.04수정 2023.09.26 🟩 Vegan- biplot이란 하나의 그림에 두 개의 데이터를 보여주는 plot이다. - Vegan 패키지는 환경데이터를 처리 및 분석에 사용된다. 마이크로바이옴 데이터와 환경데이터는 샘플이름이 열에, 환경 또는 미생물의 이름이 행에 위치(혹은 그 반대)하는 feature table을 분석에 이용하기 때문에, 많은 분석 방법을 공유한다.- 이 중에서 vegan의 envfit 함수를 이용한 biplot을 phyloseq object를 사용해 그려보자.- 위처럼 샘플을 point로 나타내고, 관련 메타데이터를 arrow로 그리거나, feature(ASV)를 arrow로 표시하는 경우가 있다. 🟩 Example data- QIIME2 tutorial ..
- 찾는 조건 : 상위 10% OR IF 10점 이상 (2022기준) [MICROBIOLOGY ] Nature Microbiology - IF = 28.3 - MICROBIOLOGY JIF = 5/135 Cell Host and Microbe - IF = 30.3 - MICROBIOLOGY JIF = 4/135 ISME Journal - IF = 11.0 - MICROBIOLOGY JIF 14/135 = 상위 10% trends in microbiology - IF = 15.9 - MICROBIOLOGY JIF 6/135 = 상위 6% Microbiome - IF = 13.78 - MICROBIOLOGY JIF 7/135 = 상위 5% gut microbes - IF = 9.434 - MICROBIOLO..

1. https://github.com/Dijji/FileMeta/releases 최근 판 다운로드 2. 설치된 File Meta Association Maneger을 실행한다. 3. File extensions 창에서 pdf 파일 형식을 찾고 -> Add file Meta handler를 실행한다. - pdf파일의 속성이 none -> file Meta property Handler로 바뀌었을 것이다. 4. 이제 윈도우 파일 탐색기의 보기 옵션을 수정한다. - 세부정보창 보기를 선택한다. - pdf파일을 클릭하면 기존에 없던 태그 추가, 등급 등의 내용이 추가된 것을 볼 수 있다. 개발자인 Dijji님이 2021년도에 돌아가셔서, Github의 질의를 올려도 아무도 대답해 주지 않는다. 따님께서 대신 ..

- 작성 : 2023.08.29 1. MicrobiomeMarker 패키지에 대해서 - 논문 : Cao, Y., Dong, Q., Wang, D., Zhang, P., Liu, Y., & Niu, C. (2022). microbiomeMarker: an R/Bioconductor package for microbiome marker identification and visualization. Bioinformatics (Oxford, England), 38(16), 4027–4029. https://doi.org/10.1093/bioinformatics/btac438 - 인용수 : 34 (2023.08.29 기준) - 공식 문서 : https://yiluheihei.github.io/microbiomeM..

작성: 2023-08-25 Metacoder란? - 공식 튜토리얼 : https://grunwaldlab.github.io/metacoder_documentation/workshop--05--plotting.html - 논문 : Foster, Z. S., Sharpton, T. J., & Grünwald, N. J. (2017). Metacoder: An R package for visualization and manipulation of community taxonomic diversity data. PLoS computational biology, 13(2), e1005404. https://doi.org/10.1371/journal.pcbi.1005404 - 인용수: 498(2023.08.25 기준..
Rearrangements Power Large-Scale Genomic Changes 개놈의 재배열은 이후 표현형에 치명적이거나 심각한 손상을 입힌다. 특히 유사한 DNA구간(한 염색체 내) 간의 재배열을 많이 볼 수 있다. 이때 각 유전체 블록들이 재배열 될 수 있는 경우를 구하기 위해 순열을 이용할 수 있다. Problem Given : 7 이하의 양의 정수 output : n 길이를 가진 순열(순서는 중요하지 않음) 예제 데이터와 결과 Sample Dataset 3 Samplpe output 6 # 순열의 개수 : n 1 2 3 # 순열 예시 (순서는 상관없음) 1 3 2 2 1 3 2 3 1 3 1 2 3 2 1 - 3*2*1 = 6 - 만약 n = 7이라면, length는 7*6*5*4*3*2..